pJL50
(Plasmid
#174068)
-
PurposeExpresses 97-3 zinc finger array fused to VP16 in S. cerevisiae. Parent plasmid for chromatin regulator library.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneunknown
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepTEF1-3NLS-97-3ZF-VP16
-
SpeciesS. cerevisiae (budding yeast), Synthetic
- Promoter pTEF1
-
Tag
/ Fusion Protein
- FLAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer unknown
- 3′ sequencing primer catcgcgttaattaatagacaactc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byKeung, A.J., Bashor, C.J., Kiriakov, S., Collins, J.J., and Khalil, A.S. (2014). Using Targeted Chromatin Regulators to Engineer Combinatorial and Spatial Transcriptional Regulation. Cell 158, 110-120. 10.1016/j.cell.2014.04.047.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL50 was a gift from Albert Keung (Addgene plasmid # 174068 ; http://n2t.net/addgene:174068 ; RRID:Addgene_174068) -
For your References section:
Mapping the dynamic transfer functions of eukaryotic gene regulation. Lee JB, Caywood LM, Lo JY, Levering N, Keung AJ. Cell Syst. 2021 Aug 24. pii: S2405-4712(21)00291-X. doi: 10.1016/j.cels.2021.08.003. 10.1016/j.cels.2021.08.003 PubMed 34469745