pJL32
(Plasmid #174066)

• Purpose: Encodes for CIB1 fused to VP16 in S. cerevisiae. Part of optogenetic system.
• Depositing Lab: Albert Keung
• Publication: Lee et al Cell Syst. 2021 Aug 24. pii: S2405-4712(21)00291-X. doi: 10.1016/j.cels.2021.08.003.

Backbone

• Vector backbone: unknown
• Vector type: Yeast Expression
• Selectable markers: HIS3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pGal1-LacO-3NLS-CIB1-VP16-tADH1
• Species: S. cerevisiae (budding yeast), A. thaliana (mustard weed), Synthetic
• Promoter: pGal1
• Tag / Fusion Protein:
  • FLAG

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: unknown
• 3′ sequencing primer: catcgcgttaattaatagacaactc

Resource Information

• Supplemental Documents:
  • pJL32.ape
• A portion of this plasmid was derived from a plasmid made by: ennedy, M.J., Hughes, R.M., Peteya, L.A., Schwartz, J.W., Ehlers, M.D., and Tucker, C.L. (2010). Rapid blue-light-mediated induction of protein interactions in living cells. Nature Methods 7, 973-U948. 10.1038/nmeth.1524. and Keung, A.J., Bashor, C.J., Kiriakov, S., Collins, J.J., and Khalil, A.S. (2014). Using Targeted Chromatin Regulators to Engineer Combinatorial and Spatial Transcriptional Regulation. Cell 158, 110-120. 10.1016/j.cell.2014.04.047

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint.

Please note: The plasmid contains a 217bp insertion between Tadh1 and HIS3 3'UTR compared to the depositor's provided sequence. This insertion is not known to affect plasmid function.