Skip to main content
Addgene

pJL29
(Plasmid #174063)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174063 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    unknown
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2x43-8 ZFO-1x97-4 ZFO pCyc mCherry tCyc
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Promoter pCyc1
  • Tag / Fusion Protein
    • FLAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ClaI (unknown if destroyed)
  • 3′ cloning site EagI (unknown if destroyed)
  • 5′ sequencing primer cgactcactatagggcgaattg
  • 3′ sequencing primer unknown
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Keung, A.J., Bashor, C.J., Kiriakov, S., Collins, J.J., and Khalil, A.S. (2014). Using Targeted Chromatin Regulators to Engineer Combinatorial and Spatial Transcriptional Regulation. Cell 158, 110-120. 10.1016/j.cell.2014.04.047

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL29 was a gift from Albert Keung (Addgene plasmid # 174063 ; http://n2t.net/addgene:174063 ; RRID:Addgene_174063)

  • For your References section:

    Mapping the dynamic transfer functions of eukaryotic gene regulation. Lee JB, Caywood LM, Lo JY, Levering N, Keung AJ. Cell Syst. 2021 Aug 24. pii: S2405-4712(21)00291-X. doi: 10.1016/j.cels.2021.08.003. 10.1016/j.cels.2021.08.003 PubMed 34469745
Related items: