Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC19-whiteCopyCatcher
(Plasmid #174062)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174062 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    white
  • Alt name
    SA-T2A-DsRed-white gRNA-mCerulean
  • gRNA/shRNA sequence
    GCAGTGAAGCCTCGCTAAGGAGG
  • Species
    D. melanogaster (fly), Synthetic
  • Entrez Gene
    w (a.k.a. Dmel_CG2759, BACN33B1.1, CG2759, DMWHITE, DmWhite, Dmel\CG2759, EG:BACN33B1.1, W, White, c23, e(g), m(g), mini-white, mw, w(AT)[[13]])

Cloning Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-whiteCopyCatcher was a gift from Ethan Bier (Addgene plasmid # 174062 ; http://n2t.net/addgene:174062 ; RRID:Addgene_174062)
  • For your References section:

    CopyCatchers are versatile active genetic elements that detect and quantify inter-homolog somatic gene conversion. Li Z, Marcel N, Devkota S, Auradkar A, Hedrick SM, Gantz VM, Bier E. Nat Commun. 2021 May 11;12(1):2625. doi: 10.1038/s41467-021-22927-1. 10.1038/s41467-021-22927-1 PubMed 33976171