pTol2-HybridBarcode
(Plasmid
#174037)
-
PurposeFor Tol2 transgenesis of expressed barcode containing SpyCas9, SauCas9, and LbCas12a target sites
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTol2
- Backbone size w/o insert (bp) 11000
- Total vector size (bp) 11500
-
Vector typeTol2 transgenesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCRISPR target sites
-
SpeciesSynthetic
-
Insert Size (bp)429
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGTAGAAATCCGGACTCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.11.07.372151v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol2-HybridBarcode was a gift from James Gagnon (Addgene plasmid # 174037 ; http://n2t.net/addgene:174037 ; RRID:Addgene_174037) -
For your References section:
Orthogonal CRISPR-Cas tools for genome editing, inhibition, and CRISPR recording in zebrafish embryos. Takasugi PR, Wang S, Truong KT, Drage EP, Kanishka SN, Higbee MA, Bamidele N, Ojelabi O, Sontheimer EJ, Gagnon JA. Genetics. 2021 Nov 4. pii: 6420709. doi: 10.1093/genetics/iyab196. 10.1093/genetics/iyab196 PubMed 34735006