Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC19-TgKI-MCS-p2A-Venus-PEST-MCS-polyA
(Plasmid #174030)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174030 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Vector type
    Zebrafish knock-in tagging

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p2A-Venus-PEST
  • Species
    Synthetic
  • Insert Size (bp)
    906

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer GCGATTAAGTTGGGTAACGC
  • 3′ sequencing primer TCCGGCTCGTATGTTGTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Not all restriction sites in the multiple cloning sites are single cutters, depending on the fluorescent protein sequence of the insert within the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-TgKI-MCS-p2A-Venus-PEST-MCS-polyA was a gift from Michel Bagnat (Addgene plasmid # 174030 ; http://n2t.net/addgene:174030 ; RRID:Addgene_174030)
  • For your References section:

    Knock-in tagging in zebrafish facilitated by insertion into non-coding regions. Levic DS, Yamaguchi N, Wang S, Knaut H, Bagnat M. Development. 2021 Sep 8. pii: 272090. doi: 10.1242/dev.199994. 10.1242/dev.199994 PubMed 34495314