pUC19-TgKI-MCS-mScarlet-MCS-polyA
(Plasmid
#174023)
-
PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
-
Vector typeZebrafish knock-in tagging
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemScarlet
-
SpeciesSynthetic
-
Insert Size (bp)696
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer GCGATTAAGTTGGGTAACGC
- 3′ sequencing primer TCCGGCTCGTATGTTGTGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Not all restriction sites in the multiple cloning sites are single cutters, depending on the fluorescent protein sequence of the insert within the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-TgKI-MCS-mScarlet-MCS-polyA was a gift from Michel Bagnat (Addgene plasmid # 174023 ; http://n2t.net/addgene:174023 ; RRID:Addgene_174023) -
For your References section:
Knock-in tagging in zebrafish facilitated by insertion into non-coding regions. Levic DS, Yamaguchi N, Wang S, Knaut H, Bagnat M. Development. 2021 Sep 8. pii: 272090. doi: 10.1242/dev.199994. 10.1242/dev.199994 PubMed 34495314