pDB4961
(Plasmid
#174015)
-
PurposepHIS3H plasmid expressing 13Myc-Vps15 from 41nmt1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174015 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHIS3H-41nmt1p-13Myc
-
Backbone manufacturerLi-Lin Du's lab
- Backbone size w/o insert (bp) 7500
-
Modifications to backboneAscI to digest the vector, and insert Vps15 into it
-
Vector typeYeast Expression
-
Selectable markersHygromycin, HIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVps15
-
Alt nameppk19
-
Alt nameSPBC119.07
-
SpeciesS. pombe (fission yeast)
-
Insert Size (bp)5121
-
GenBank IDNP_595288.1
-
Entrez Geneppk19 (a.k.a. SPBC119.07, vps15)
- Promoter 41nmt1
-
Tag
/ Fusion Protein
- 13Myc, Vps15 (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GtATTCGCGCCGGCGCGCCAATGGGGATTCAGCTTTCCAC
- 3′ sequencing primer CTTATTTAGAAGTGGCGCGCCCTAGGTCCAGAGTTCAAGACTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Visit https://www.biorxiv.org/content/10.1101/2021.04.13.439745v1 for the preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDB4961 was a gift from Li-Lin Du (Addgene plasmid # 174015 ; http://n2t.net/addgene:174015 ; RRID:Addgene_174015) -
For your References section:
Visual detection of binary, ternary and quaternary protein interactions in fission yeast using a Pil1 co-tethering assay. Yu ZQ, Liu XM, Zhao D, Xu DD, Du LL. J Cell Sci. 2021 Oct 1;134(19):jcs258774. doi: 10.1242/jcs.258774. Epub 2021 Oct 12. 10.1242/jcs.258774 PubMed 34499173