pGL3-noSV40-humanEC1.45_min1-2
(Plasmid
#173952)
-
PurposeFirefly luciferase enhancer reporter plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173952 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL3-Promoter, GenBank: U47298.2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5016
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMinimal enhancer regions 1 and 2 (min1 and min2) from SOX9 enhancer cluster EC1.45
-
SpeciesH. sapiens (human)
-
Insert Size (bp)488
-
MutationNone
- Promoter SV40 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CGCTCTCCATCAAAACAAAACG
- 3′ sequencing primer GAGTTAGGGGCGGGATGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-noSV40-humanEC1.45_min1-2 was a gift from Joanna Wysocka (Addgene plasmid # 173952 ; http://n2t.net/addgene:173952 ; RRID:Addgene_173952) -
For your References section:
Loss of Extreme Long-Range Enhancers in Human Neural Crest Drives a Craniofacial Disorder. Long HK, Osterwalder M, Welsh IC, Hansen K, Davies JOJ, Liu YE, Koska M, Adams AT, Aho R, Arora N, Ikeda K, Williams RM, Sauka-Spengler T, Porteus MH, Mohun T, Dickel DE, Swigut T, Hughes JR, Higgs DR, Visel A, Selleri L, Wysocka J. Cell Stem Cell. 2020 Nov 5;27(5):765-783.e14. doi: 10.1016/j.stem.2020.09.001. Epub 2020 Sep 28. 10.1016/j.stem.2020.09.001 PubMed 32991838