pCMV-Spike-VLP
(Plasmid #173922)

• Purpose: Expresses virus-like particles based upon the original SARS-Cov-2
• Depositing Lab: Andreas Stuermer
• Publication: Plasmids expressing the original SARS-Coronavirus 2 Spike Protein (unpublished)

Backbone

• Vector backbone: pUC57-Kan
• Backbone size w/o insert (bp): 2539
• Total vector size (bp): 8996
• Modifications to backbone: EcoRV on both ends allows linearization. LoxP allows rapid knock-in after re-circularization.
• Vector type: Mammalian Expression, Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: SARS-2 Spike Protein
• Species: H. sapiens (human), Synthetic; SARS-COV-2
• Insert Size (bp): 3819
• Entrez Gene: S (a.k.a. GU280_gp02, spike glycoprotein)
• Promoter: CMV
• Tag / Fusion Protein:
  • no tags, native protein

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CMV-f CGCAAATGGGCGGTAGGCGTG

Gene/Insert 2

• Gene/Insert name: SARS-Cov-2 E protein
• Species: H. sapiens (human), Synthetic; SARS-COV-2
• Insert Size (bp): 228
• Entrez Gene: E (a.k.a. GU280_gp04)
• Promoter: 22bp IRES

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: tgctttgcttgtacagtaagg

Gene/Insert 3

• Gene/Insert name: SARS-Cov-2 M Protein
• Species: H. sapiens (human), Synthetic; SARS-COV-2
• Insert Size (bp): 669
• Entrez Gene: M (a.k.a. GU280_gp05)
• Promoter: IE2 Promoter/Enhancer from Mouse MCMV

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: gattccaacggtactattacc

Resource Information

• Supplemental Documents:
  • pCMV-Spike-VLP in pUC57-Kan.gb
  • pCMV-Spike-VLP in pUC57-Kan neat.gb
• A portion of this plasmid was derived from a plasmid made by: Synthetic DNA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA