Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSBbi-RB-PE2
(Plasmid #173902)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173902 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSBbi-RB
  • Backbone manufacturer
    Kowarz Lab (Addgene Plasmid #60522)
  • Backbone size w/o insert (bp) 2021
  • Total vector size (bp) 8374
  • Modifications to backbone
    PE2 cloned between the SfiI restriction sites
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PE2
  • Alt name
    Cas9(H840A)-M-MLVrt(D200N, T306K, W313F, T330P, L603W)
  • Species
    Synthetic
  • Insert Size (bp)
    6354
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on backbone)
    • SV40 NLS (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCCTCAGACAGTGGTTCAAAG
  • 3′ sequencing primer AGGCACAGTCGAGGCTGAT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    PE2 sequence was cloned from the pCMV-PE2 plasmid (Addgene Plasmid #132775)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-RB-PE2 was a gift from Ronald Cohn (Addgene plasmid # 173902 ; http://n2t.net/addgene:173902 ; RRID:Addgene_173902)