pMT85_P438-mEOS3.2_GentaR
(Plasmid
#173894)
-
PurposeTransposon allowing the expression of the fluorescent protein mEos3.2 in multiple mycoplasma species, under the control of the P438 promoter
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173894 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepMT85-2res
- Total vector size (bp) 6090
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemEos3.2
-
SpeciesLobophyllia hemprichii
-
Insert Size (bp)680
- Promoter P438
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GATAAAGTCCGTATAATTGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMT85_P438-mEOS3.2_GentaR was a gift from Yonathan Arfi (Addgene plasmid # 173894 ; http://n2t.net/addgene:173894 ; RRID:Addgene_173894) -
For your References section:
Imaging Minimal Bacteria at the Nanoscale: a Reliable and Versatile Process to Perform Single-Molecule Localization Microscopy in Mycoplasmas. Rideau F, Villa A, Belzanne P, Verdier E, Hosy E, Arfi Y. Microbiol Spectr. 2022 Jun 29;10(3):e0064522. doi: 10.1128/spectrum.00645-22. Epub 2022 May 31. 10.1128/spectrum.00645-22 PubMed 35638916
Map uploaded by the depositor.
