pUFlip-floxed2A-KalTA4-; gcry1:BFP -1
(Plasmid #173890)

• Purpose: Donor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld method
• Depositing Lab: Jeffrey Essner
• Publication: Liu et al Elife. 2022 Jun 17;11. pii: 71478. doi: 10.7554/eLife.71478.

Backbone

• Vector backbone: pK
• Backbone manufacturer: Karl J. Clark
• Backbone size w/o insert (bp): 2730
• Total vector size (bp): 7496
• Vector type: Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 2A-KalTA4; gcry1: BFP
• Alt name: P2A-monomeric KalTA4 gamma crystallin 1: BFP
• Species: D. rerio (zebrafish)
• Insert Size (bp): 4766

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aaaagcaagaaagaaaactagagtgg
• 3′ sequencing primer: atggctcataacaccccttg

Resource Information

• Supplemental Documents:
  • pUFlip-floxed2A-KalTA4-; gcry1:BFP -1

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note PacCI sites have replaced the BfuAI sites within the initial versions of these vectors created by the Essner lab.

Please visit https://www.biorxiv.org/content/10.1101/2021.06.18.448732v1 for bioRxiv preprint.