AktPH-mCherry-T2A-PHR-iSH-T2A-CIBNcaax
(Plasmid #173862)

• Purpose: Mammalian expression of Akt PH-mCherry-T2A-PHR-iSH-T2A-CIBNcaax (PIP3 marker and opto-PI3K)
• Depositing Lab: Takao Nakata
• Publication: Kakumoto et al PLoS One. 2013 Aug 7;8(8):e70861. doi: 10.1371/journal.pone.0070861. eCollection 2013.

Backbone

• Vector backbone: pCAG-N1 (modified pEGFP-N1)
• Backbone manufacturer: Modified from Clontech
• Backbone size w/o insert (bp): 5085
• Total vector size (bp): 9135
• Modifications to backbone: CMV promoter was replaced by CAG promoter, and EGFP was removed.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AktPH-mCherry-T2A-PHR-iSH-T2A-CIBNcaax
• Species: H. sapiens (human), M. musculus (mouse), A. thaliana (mustard weed)
• Insert Size (bp): 4050
• Promoter: CAG
• Tags / Fusion Proteins:
  • mCherry (C terminal on insert)
  • C-terminal CAAX-box (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: TGGTTATTGTGCTGTCTCATC
• 3′ sequencing primer: AAGTAAAACCTCTACAAATGTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry