Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUAS-Myc-BirA-G3-ER
(Plasmid #173815)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173815 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pWalium10-roe
  • Backbone manufacturer
    Drosophila Genomics Resource Center
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Myc-BirA-G3-ER
  • Alt name
    BirA-G3-ER
  • Alt name
    BiP-Myc-BirA-G3-KDEL
  • Promoter UAS
  • Tag / Fusion Protein
    • Myc

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer accagcaaccaagtaaatcaac
  • 3′ sequencing primer TAATCGTGTGTGATGCCTACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

BirA-G3 sequence obtained from the Ting Lab:

Branon TC, Bosch JA, Sanchez AD, Udeshi ND, Svinkina T, Carr SA, Feldman JL, Perrimon N, Ting AY. Efficient proximity labeling in living cells and organisms with TurboID. Nat Biotechnol. 2018 Oct;36(9):880-887. doi: 10.1038/nbt.4201. Epub 2018 Aug 20. Erratum in: Nat Biotechnol. 2020 Jan;38(1):108. PMID: 30125270; PMCID: PMC6126969.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUAS-Myc-BirA-G3-ER was a gift from Norbert Perrimon (Addgene plasmid # 173815 ; http://n2t.net/addgene:173815 ; RRID:Addgene_173815)
  • For your References section:

    Proteomics of protein trafficking by in vivo tissue-specific labeling. Droujinine IA, Meyer AS, Wang D, Udeshi ND, Hu Y, Rocco D, McMahon JA, Yang R, Guo J, Mu L, Carey DK, Svinkina T, Zeng R, Branon T, Tabatabai A, Bosch JA, Asara JM, Ting AY, Carr SA, McMahon AP, Perrimon N. Nat Commun. 2021 Apr 22;12(1):2382. doi: 10.1038/s41467-021-22599-x. 10.1038/s41467-021-22599-x PubMed 33888706