pITGA5_1745G>U
(Plasmid
#173812)
-
Purposemir218 binding site2 point mutation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173812 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC-GW-Kan
-
Backbone manufacturerGenewiz
- Backbone size w/o insert (bp) 2626
- Total vector size (bp) 2727
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNT1745 ITGA5 point mutation
-
gRNA/shRNA sequenceTGGAGTACAAGTCCTTGCAG
-
SpeciesH. sapiens (human)
-
GenBank ID3678
-
Entrez GeneITGA5 (a.k.a. CD49e, FNRA, VLA-5, VLA5A)
- Promoter AmpR
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAC GGC GGT CAC TGT TCC T (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenewiz Inc.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pITGA5_1745G>U was a gift from Andrew M. Siedlecki (Addgene plasmid # 173812 ; http://n2t.net/addgene:173812 ; RRID:Addgene_173812) -
For your References section:
Integrin alpha5 Is Regulated by miR-218-5p in Endothelial Progenitor Cells. Liu J, Li Y, Lyu L, Xiao L, Memon AA, Yu X, Halim A, Patel S, Osman A, Yin W, Jiang J, Naini S, Lim K, Zhang A, Williams JD, Koester R, Qi KZ, Fucci QA, Ding L, Chang S, Patel A, Mori Y, Chaudhari A, Bao A, Liu J, Lu TS, Siedlecki A. J Am Soc Nephrol. 2022 Mar;33(3):565-582. doi: 10.1681/ASN.2021020140. Epub 2022 Jan 28. 10.1681/ASN.2021020140 PubMed 35091451