pTM-BPL
(Plasmid
#173766)
-
PurposeFluorescent labeling of the nuclear envelope
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173766 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCI-neo vector
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5439
- Total vector size (bp) 6449
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePDGF receptor TM domain, Biotin protein ligase
-
Alt nameBPL
-
SpeciesSynthetic
-
Insert Size (bp)1010
-
GenBank ID
- Promoter CMV
-
Tags
/ Fusion Proteins
- Signal peptide (N terminal on backbone)
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer AATTAACCCTCACTAAAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTM-BPL was a gift from Shinji Sueda (Addgene plasmid # 173766 ; http://n2t.net/addgene:173766 ; RRID:Addgene_173766) -
For your References section:
Fluorescent Labeling of the Nuclear Envelope by Localizing Green Fluorescent Protein on the Inner Nuclear Membrane. Taniyama T, Tsuda N, Sueda S. ACS Chem Biol. 2018 Jun 15;13(6):1463-1469. doi: 10.1021/acschembio.8b00219. Epub 2018 May 24. 10.1021/acschembio.8b00219 PubMed 29782140