ArpC2_pLib
(Plasmid
#173679)
-
PurposeArpC2 subunit of the Human Arp2/3 complex in a library vector for the biGBac system of insect expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173679 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLib
- Backbone size w/o insert (bp) 4970
- Total vector size (bp) 5798
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameArpC2
-
Alt nameactin related protein 2/3 complex subunit 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)915
- Promoter polyhedrin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (SV40-polyA-Rev) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ArpC2_pLib was a gift from Roberto Dominguez (Addgene plasmid # 173679 ; http://n2t.net/addgene:173679 ; RRID:Addgene_173679) -
For your References section:
Cryo-EM structure of NPF-bound human Arp2/3 complex and activation mechanism. Zimmet A, Van Eeuwen T, Boczkowska M, Rebowski G, Murakami K, Dominguez R. Sci Adv. 2020 Jun 5;6(23). pii: 6/23/eaaz7651. doi: 10.1126/sciadv.aaz7651. Print 2020 Jun. 10.1126/sciadv.aaz7651 PubMed 32917641