Arp2_pLib
(Plasmid #173676)

• Purpose: Arp2 subunit of the Human Arp2/3 complex in a library vector for the biGBac system of insect expression
• Depositing Lab: Roberto Dominguez
• Publication: Zimmet et al Sci Adv. 2020 Jun 5;6(23). pii: 6/23/eaaz7651. doi: 10.1126/sciadv.aaz7651. Print 2020 Jun.

Backbone

• Vector backbone: pLib
• Backbone size w/o insert (bp): 4970
• Total vector size (bp): 6080
• Vector type: Insect Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Arp2
• Alt name: ACTR2
• Species: H. sapiens (human)
• Insert Size (bp): 1197
• Entrez Gene: ACTR2 (a.k.a. ARP2)
• Promoter: polyhedrin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TCAACAGGTTGAACTGCTGATC
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC (SV40-polyA-Rev)

Resource Information

• Supplemental Documents:
  • Arp2_pLib.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry