Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lenti-sgNcor1#2/Cre
(Plasmid #173606)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173606 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLL3.3
  • Vector type
    Lentiviral, Cre/Lox, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting Ncor1
  • gRNA/shRNA sequence
    CAATATGAATGGGCTGATGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ncor1 (a.k.a. 5730405M06Rik, A230020K14Rik, N-CoR, RIP13, Rxrip13, mKIAA1047)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-sgNcor1#2/Cre was a gift from Charles Swanton (Addgene plasmid # 173606 ; http://n2t.net/addgene:173606 ; RRID:Addgene_173606)
  • For your References section:

    A functional taxonomy of tumor suppression in oncogenic KRAS-driven lung cancer. Cai H, Chew SK, Li C, Tsai MK, Andrejka L, Murray CW, Hughes NW, Shuldiner EG, Ashkin EL, Tang R, Hung KL, Chen LC, Lee SYC, Yousefi M, Lin WY, Kunder CA, Cong L, McFarland CD, Petrov DA, Swanton C, Winslow MM. Cancer Discov. 2021 Feb 19. pii: 2159-8290.CD-20-1325. doi: 10.1158/2159-8290.CD-20-1325. 10.1158/2159-8290.CD-20-1325 PubMed 33608386