pPBT-PE2-PuroTK-pegRNA_GG
(Plasmid #173222)

• Purpose: piggyBac transposon containing both PE2 and a pegRNA cloning site.
• Depositing Lab: Jacob Giehm Mikkelsen
• Publication: Wolff et al Front Genome Ed. 2021 Nov 12;3:786893. doi: 10.3389/fgeed.2021.786893. eCollection 2021.

Backbone

• Vector backbone: pPBT
• Total vector size (bp): 14039
• Vector type: Mammalian Expression ; piggyBac
• Selectable markers: Puromycin ; PuroTK

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PE2
• Alt name: Prime editor 2
• Alt name: SpCas9(H840A)-M-MLV-RT
• Species: Synthetic
• Insert Size (bp): 6351
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCAAAATGTCGTAACAACTCCGCCC
• 3′ sequencing primer: GCGGTCCGGATCGACGGTGT

Gene/Insert 2

• Gene/Insert name: PuroTK
• Insert Size (bp): 1568
• Promoter: P2A

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCCGGAGATGTCGAAGAGAA
• 3′ sequencing primer: CTCAGACAATGCGATGCAAT

Gene/Insert 3

• Gene/Insert name: pegRNA cloning cassette
• Alt name: pegRNA-GG-acceptor (BsmBI)
• Insert Size (bp): 678
• Promoter: hU6

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGGGCCTATTTCCCATGAT

Resource Information

• Supplemental Documents:
  • pPBT-PE2-PuroTK-pegRNA_GG.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry