pPBT-PE2-PGK-Blast
(Plasmid #173219)

• Purpose: piggyBac transposon containing PE2 and Blasticidin expression cassettes
• Depositing Lab: Jacob Giehm Mikkelsen
• Publication: Wolff et al Front Genome Ed. 2021 Nov 12;3:786893. doi: 10.3389/fgeed.2021.786893. eCollection 2021.

Backbone

• Vector backbone: pPBT
• Vector type: Mammalian Expression ; piggyBac
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: PE2
• Alt name: Prime editor 2
• Alt name: SpCas9(H840A)-M-MLV-RT
• Species: Synthetic
• Insert Size (bp): 6351
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCAAAATGTCGTAACAACTCCGCCC
• 3′ sequencing primer: CCATAGAGCCCACCGCATC

Gene/Insert 2

• Gene/Insert name: Blast
• Alt name: Blasticidin
• Alt name: Blast
• Insert Size (bp): 399
• Promoter: hPGK

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cagtcggctccctcgttgac

Resource Information

• Supplemental Documents:
  • pPBT-PE2-PGK-Blast.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry