Skip to main content
Addgene

ATP1A1_G4_Q118R_RUNX1_+4_T_to_G_Dual_pegRNA
(Plasmid #173212)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173212 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pU6-pegRNA-GG-acceptor
  • Total vector size (bp) 2706
  • Vector type
    Mammalian Expression, CRISPR ; Prime editing

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP1A1 G4 Q118R pegRNA + RUNX1 +4 T to G pegRNA
  • gRNA/shRNA sequence
    GTTCCTCTTCTGTAGCAGCT and GCATTTTCAGGAGGAAGCGA
  • Species
    H. sapiens (human)
  • Promoter Tandem U6 promoters

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
  • 3′ sequencing primer GGGAAACGCCTGGTATCTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Control pegRNA vector derived from ATP1A1_G4_Q118R_Dual_pegRNA. This vector can be used as a positive control for prime editing (PE3 in combination with ATP1A1_G3_RUNX1_Nick-38_Dual_sgRNA) to co-target ATP1A1 and RUNX1 to perform coselection for RUNX1 +4 T to G. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ATP1A1_G4_Q118R_RUNX1_+4_T_to_G_Dual_pegRNA was a gift from Yannick Doyon (Addgene plasmid # 173212 ; http://n2t.net/addgene:173212 ; RRID:Addgene_173212)
  • For your References section:

    Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338