Skip to main content
Addgene

pX330_ATP1A1_G7_Dual_sgRNA
(Plasmid #173206)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173206 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Total vector size (bp) 8804
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP1A1 G7 sgRNA + user-specified sgRNA + SpCas9
  • gRNA/shRNA sequence
    GTCACAGATCGATAGTAGTG
  • Species
    H. sapiens (human)
  • Promoter Dual U6 promoters

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site SbfI (not destroyed)
  • 5′ sequencing primer GGATTGGGAAGACAATAGCAGGC
  • 3′ sequencing primer GTCCCTATTGGCGTTACTATTGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ATP1A1 G7 sgRNA target ATP1A1 intron 17 and this plasmid can be used to perform coselection for HDR in human cells. This plasmid is derived from pX330-U6-Chimeric_BB-CBh-hSpCas9 and user-specified sgRNA can be cloned using the BbsI sites. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330_ATP1A1_G7_Dual_sgRNA was a gift from Yannick Doyon (Addgene plasmid # 173206 ; http://n2t.net/addgene:173206 ; RRID:Addgene_173206)
  • For your References section:

    Marker-free co-selection for successive rounds of prime editing in human cells. Levesque S, Mayorga D, Fiset JP, Goupil C, Duringer A, Loiselle A, Bouchard E, Agudelo D, Doyon Y. Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z. 10.1038/s41467-022-33669-z PubMed 36207338