eSpCas9(1.1)_No_FLAG_ATP1A1-G7
(Plasmid #173203)

• Purpose: Expresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.
• Depositing Lab: Yannick Doyon
• Publication: Levesque et al Nat Commun. 2022 Oct 7;13(1):5909. doi: 10.1038/s41467-022-33669-z.

Backbone

• Vector backbone: pX330-U6-Chimeric_BB-CBh-hSpCas9
• Total vector size (bp): 8439
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
• gRNA/shRNA sequence: GTCACAGATCGATAGTAGTG
• Species: H. sapiens (human)
• Promoter: U6 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: GAGGGCCTATTTCCCATGATT

Resource Information

• Supplemental Documents:
  • eSpCas9(1.1)_No_FLAG_ATP1A1_G7.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

ATP1A1 G7 sgRNA target ATP1A1 intron 17 and this plasmid can be used to directly target a transgene to the ATP1A1 locus itselft, including the mTOR Signaling Indicator (TOSI) using ATP1A1_T804N_hPGK1_mScarlet-I-TOSI_Donor.
This plasmid is derived from eSpCas9(1.1) (Plasmid #71814) from Feng Zhang's lab. The 3x FLAG sequence was removed to prevent interference of the tag in western blot and immunoprecipitation applications. Please visit https://doi.org/10.1101/2021.11.02.464583 for bioRxiv preprint.