pMito-HyPerGRt
(Plasmid #173197)

• Purpose: HyPer7 and tdTomato fusion to detect mitochondrial hydrogen peroxide
• Depositing Lab: Huiwang Ai
• Publication: Li et al ACS Sens. 2022 Feb 28. doi: 10.1021/acssensors.1c01381.

Backbone

• Vector backbone: pCS2+
• Backbone size w/o insert (bp): 4088
• Total vector size (bp): 7178
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Hyper7-tdTomato
• Alt name: HyPerGRT
• Species: Synthetic
• Insert Size (bp): 3089
• Promoter: CMV IE94 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH I (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: tacaagctacttgttctttttgcag
• 3′ sequencing primer: tggatctacgtaatacgactcactata

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry