Skip to main content
Addgene

pM201
(Plasmid #173179)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173179 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pHAGE-DEST
  • Backbone size w/o insert (bp) 6479
  • Total vector size (bp) 12480
  • Modifications to backbone
    2xtetO deletion
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-24xGCN4
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    6000
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer tgtacggtgggaggtctata
  • 3′ sequencing primer agttaagaataccagtcaatctttcac
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pM201 was a gift from Hajin Kim (Addgene plasmid # 173179 ; http://n2t.net/addgene:173179 ; RRID:Addgene_173179)

  • For your References section:

    Background-suppressed live visualization of genomic loci with an improved CRISPR system based on a split fluorophore. Chaudhary N, Nho SH, Cho H, Gantumur N, Ra JS, Myung K, Kim H. Genome Res. 2020 Sep;30(9):1306-1316. doi: 10.1101/gr.260018.119. Epub 2020 Sep 4. 10.1101/gr.260018.119 PubMed 32887690
Related items:
Commonly requested with: