Skip to main content
Addgene

pKD279.8
(Plasmid #173171)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173171 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    ColE1
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SO_4388(REC)-PsdR(DBD) 137
  • Species
    Shewanella oneidensis, Bacillus subtilis
  • Promoter J23108

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    sfGFP
  • Species
    Aequorea victoria
  • Promoter PpsdA110

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer TCGCTCAAGGCGCACTCC
  • 3′ sequencing primer TAGGAAGCTTGCATGCCTGCAGGTC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKD279.8 was a gift from Jeffrey Tabor (Addgene plasmid # 173171 ; http://n2t.net/addgene:173171 ; RRID:Addgene_173171)

  • For your References section:

    Mucosal acidosis elicits a unique molecular signature in epithelia and intestinal tissue mediated by GPR31-induced CREB phosphorylation. Cartwright IM, Dowdell AS, Lanis JM, Brink KR, Mu A, Kostelecky RE, Schaefer REM, Welch N, Onyiah JC, Hall CHT, Gerich ME, Tabor JJ, Colgan SP. Proc Natl Acad Sci U S A. 2021 May 18;118(20). pii: 2023871118. doi: 10.1073/pnas.2023871118. 10.1073/pnas.2023871118 PubMed 33972436
Related items:
Commonly requested with: