Skip to main content
Addgene

pMXS-IRES-Blast mAtg7
(Plasmid #173170)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173170 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMXS-IRES-Blast
  • Backbone manufacturer
    Cell Biolabs
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 7800
  • Vector type
    Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Autophagy Related 7
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2200
  • Mutation
    Synonymous mutations at sgRNA sites
  • Entrez Gene
    Atg7 (a.k.a. 1810013K23Rik, Agp7, Apg7l, Atg7l, Gm21553)
  • Promoter MMLV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTAGACGGCATCGCAGCTTGGATA
  • 3′ sequencing primer CCTCACATTGCAAAAGACGGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXS-IRES-Blast mAtg7 was a gift from Kivanc Birsoy (Addgene plasmid # 173170 ; http://n2t.net/addgene:173170 ; RRID:Addgene_173170)

  • For your References section:

    Functional Genomics In Vivo Reveal Metabolic Dependencies of Pancreatic Cancer Cells. Zhu XG, Chudnovskiy A, Baudrier L, Prizer B, Liu Y, Ostendorf BN, Yamaguchi N, Arab A, Tavora B, Timson R, Heissel S, de Stanchina E, Molina H, Victora GD, Goodarzi H, Birsoy K. Cell Metab. 2020 Oct 28. pii: S1550-4131(20)30550-7. doi: 10.1016/j.cmet.2020.10.017. 10.1016/j.cmet.2020.10.017 PubMed 33152324
Related items:
Commonly requested with: