pMXS-IRES-Blast HA-GPAT4
(Plasmid
#173168)
-
PurposeRetroviral vector to express sgRNA resistant HA tagged human GPAT4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMXS-IRES-Blast
-
Backbone manufacturerCell Biolabs
- Backbone size w/o insert (bp) 5600
- Total vector size (bp) 7100
-
Vector typeRetroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGlycerol-3-Phosphate Acyltransferase 4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1500
-
MutationSynonymous mutations at sgRNA sites
-
Entrez GeneGPAT4 (a.k.a. 1-AGPAT 6, AGPAT6, LPAAT-zeta, LPAATZ, TSARG7)
- Promoter MMLV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAGACGGCATCGCAGCTTGGATA
- 3′ sequencing primer CCTCACATTGCAAAAGACGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXS-IRES-Blast HA-GPAT4 was a gift from Kivanc Birsoy (Addgene plasmid # 173168 ; http://n2t.net/addgene:173168 ; RRID:Addgene_173168) -
For your References section:
CHP1 Regulates Compartmentalized Glycerolipid Synthesis by Activating GPAT4. Zhu XG, Nicholson Puthenveedu S, Shen Y, La K, Ozlu C, Wang T, Klompstra D, Gultekin Y, Chi J, Fidelin J, Peng T, Molina H, Hang HC, Min W, Birsoy K. Mol Cell. 2019 Apr 4;74(1):45-58.e7. doi: 10.1016/j.molcel.2019.01.037. Epub 2019 Mar 4. 10.1016/j.molcel.2019.01.037 PubMed 30846317