Skip to main content
Addgene

pMXS-IRES-Blast HA-GPAT4
(Plasmid #173168)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173168 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMXS-IRES-Blast
  • Backbone manufacturer
    Cell Biolabs
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 7100
  • Vector type
    Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Glycerol-3-Phosphate Acyltransferase 4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • Mutation
    Synonymous mutations at sgRNA sites
  • Entrez Gene
    GPAT4 (a.k.a. 1-AGPAT 6, AGPAT6, LPAAT-zeta, LPAATZ, TSARG7)
  • Promoter MMLV
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTAGACGGCATCGCAGCTTGGATA
  • 3′ sequencing primer CCTCACATTGCAAAAGACGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXS-IRES-Blast HA-GPAT4 was a gift from Kivanc Birsoy (Addgene plasmid # 173168 ; http://n2t.net/addgene:173168 ; RRID:Addgene_173168)
  • For your References section:

    CHP1 Regulates Compartmentalized Glycerolipid Synthesis by Activating GPAT4. Zhu XG, Nicholson Puthenveedu S, Shen Y, La K, Ozlu C, Wang T, Klompstra D, Gultekin Y, Chi J, Fidelin J, Peng T, Molina H, Hang HC, Min W, Birsoy K. Mol Cell. 2019 Apr 4;74(1):45-58.e7. doi: 10.1016/j.molcel.2019.01.037. Epub 2019 Mar 4. 10.1016/j.molcel.2019.01.037 PubMed 30846317