pAAV-GFAP-jGCaMP7c variant 1513
(Plasmid
#173159)
-
PurposeExpresses jGCaMP7c variant 1513 in astrocytes
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173159 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepAAV-GFAP-EGFP
- Backbone size w/o insert (bp) 4764
- Total vector size (bp) 6118
-
Modifications to backboneEcoRI site was removed upon cloning
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namejGCaMP7c variant 1513-WPRE
-
Alt nameJanelia GCaMP7
-
SpeciesR. norvegicus (rat), G. gallus (chicken); A. victoria
-
Insert Size (bp)1353
-
GenBank IDMK749394
- Promoter GFAP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer TCATAAAGCCCTCGCATCCC
- 3′ sequencing primer AGCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe gene jGCaMP7c comes from Addgene plasmid #105321.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-GFAP-jGCaMP7c variant 1513 was a gift from Hervé Chneiweiss & Vincent Vialou (Addgene plasmid # 173159 ; http://n2t.net/addgene:173159 ; RRID:Addgene_173159)
Map uploaded by the depositor.
