pAAV syn CCR6-eLOV-TEVcs-tTA
(Plasmid
#173116)
-
PurposeExpresses CCR6 receiver construct in neurons
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173116 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCCR6-eLOV-TEVcs-tTA
- Promoter Synapsin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcagtctgcggtgggcagcggaggagtcgtgtcgt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV syn CCR6-eLOV-TEVcs-tTA was a gift from Alice Ting (Addgene plasmid # 173116 ; http://n2t.net/addgene:173116 ; RRID:Addgene_173116) -
For your References section:
A light-gated transcriptional recorder for detecting cell-cell contacts. Cho KF, Gillespie SM, Kalogriopoulos NA, Quezada MA, Jacko M, Monje M, Ting AY. Elife. 2022 Mar 21;11:e70881. doi: 10.7554/eLife.70881. 10.7554/eLife.70881 PubMed 35311648
