Skip to main content
Addgene

pVAX1-SARS-CoV-2-S HA-tag
(Plasmid #173049)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173049 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pVAX1
  • Backbone size w/o insert (bp) -1
  • Total vector size (bp) 6848
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 Spike
  • Alt name
    spike
  • Alt name
    2019-nCoV Spike
  • Species
    Synthetic; Severe acute respiratory syndrome coronavirus 2
  • Insert Size (bp)
    3848
  • GenBank ID
    NC_045512.2 NC_045512.2
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI, KpnI (unknown if destroyed)
  • 3′ cloning site BamHI,EcoRI (unknown if destroyed)
  • 5′ sequencing primer caatgggagtttgttttggc
  • 3′ sequencing primer ctggcaactagaaggcacag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Courtesy of Prof Gary Wong and Prof Dimitri Lavillette

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVAX1-SARS-CoV-2-S HA-tag was a gift from Guangxun Meng (Addgene plasmid # 173049)
  • For your References section:

    SARS-CoV-2 spike engagement of ACE2 primes S2' site cleavage and fusion initiation. Yu S, Zheng X, Zhou B, Li J, Chen M, Deng R, Wong G, Lavillette D, Meng G. Proc Natl Acad Sci U S A. 2022 Jan 4;119(1). pii: 2111199119. doi: 10.1073/pnas.2111199119. 10.1073/pnas.2111199119 PubMed 34930824