pAAV-hSyn-Flpo-3xFLAG
(Plasmid #173047)

• Purpose: AAV expression of Flpo-3xFLAG by hSyn1 promoter
• Depositing Lab: Kenji Mizuseki
• Publication: Kitanishi et al Commun Biol. 2022 Feb 21;5(1):149. doi: 10.1038/s42003-022-03096-3.

Backbone

• Vector backbone: pAAV
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Flpo
• Species: M. musculus (mouse)
• Insert Size (bp): 1281
• Promoter: hSyn1
• Tag / Fusion Protein:
  • 3xFLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: caaactccccttcccggc
• 3′ sequencing primer: atccacatagcgtaaaagga

Resource Information

• Supplemental Documents:
  • pAAV-hSyn-Flpo-3xFlag.seq
• A portion of this plasmid was derived from a plasmid made by: This construct contains sequences taken from the following plasmids: pAAV-hSyn1-tTA (Addegene, no. 99119), pAAV-EF1a-mCherry-IRES-Flpo (Addgene, no. 55634), and pSF-CMV-NEO-COOH-3XFLAG (Sigma-Aldrich, OGS629).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry