AAV-Camk2-NES-Twitch-GR
(Plasmid
#173044)
-
PurposeTnC-based calcium sensor with green-red FRET pair ratiometric readout
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneLentivirus
- Backbone size w/o insert (bp) 9251
- Total vector size (bp) 10937
-
Modifications to backbonenone
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNES-Twitch-GR
-
Insert Size (bp)1686
- Promoter CamK2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GTCAAGCCGGTTCTCCGTTTGCACTC
- 3′ sequencing primer CAGCGTATCCACATAGCGTAAAAGGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-Camk2-NES-Twitch-GR was a gift from Yiyang Gong (Addgene plasmid # 173044 ; http://n2t.net/addgene:173044 ; RRID:Addgene_173044) -
For your References section:
Rational engineering of ratiometric calcium sensors with bright green and red fluorescent proteins. Zhang D, Redington E, Gong Y. Commun Biol. 2021 Jul 29;4(1):924. doi: 10.1038/s42003-021-02452-z. 10.1038/s42003-021-02452-z PubMed 34326458