Skip to main content
Addgene

pAX198
(Plasmid #173042)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173042 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pU6-sgRNA EF1Alpha-puro-T2A-BFP
  • Total vector size (bp) 9259
  • Modifications to backbone
    Insert HBB target region
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HBB Gene - Second and third exons of ENST00000647020.1 (no intron) and part of the 3' UTR
  • gRNA/shRNA sequence
    sgGFP-NT2
  • Species
    H. sapiens (human)
  • Entrez Gene
    HBB (a.k.a. CD113t-C, ECYT6, beta-globin)
  • Promoter mouse U6

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cagcacaaaaggaaactcacc
  • 3′ sequencing primer CACCGGTTCAATTGCCGAC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAX198 was a gift from Brittany Adamson (Addgene plasmid # 173042 ; http://n2t.net/addgene:173042 ; RRID:Addgene_173042)

  • For your References section:

    Mapping the genetic landscape of DNA double-strand break repair. Hussmann JA, Ling J, Ravisankar P, Yan J, Cirincione A, Xu A, Simpson D, Yang D, Bothmer A, Cotta-Ramusino C, Weissman JS, Adamson B. Cell. 2021 Oct 28;184(22):5653-5669.e25. doi: 10.1016/j.cell.2021.10.002. Epub 2021 Oct 20. 10.1016/j.cell.2021.10.002 PubMed 34672952
Related items:
Commonly requested with: