TfR-mCh-DHFR
(Plasmid #173013)

• Purpose: For light regulated release of transferrin receptor (TfR) from the endoplasmic reticulum. Driven by CMV promoter.
• Depositing Lab: Matthew Kennedy
• Publication: Bourke et al J Cell Biol. 2021 Sep 6;220(9). pii: 212461. doi: 10.1083/jcb.202103186. Epub 2021 Jul 9.

Backbone

• Vector backbone: pJPA
• Backbone size w/o insert (bp): 4721
• Total vector size (bp): 8225
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TfR-mCh-DHFR
• Species: H. sapiens (human)
• Insert Size (bp): 3504
• Promoter: CMV
• Tags / Fusion Proteins:
  • mCherry (C terminal on insert)
  • DHFR (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: xmaI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CCTTTCTCTCCACAGGTGTC
• 3′ sequencing primer: TGCAATAAACAAGTTGGGCC

Resource Information

• Supplemental Documents:
  • pCMV TfR-mCherry-DHFR_ORF.ape
• A portion of this plasmid was derived from a plasmid made by: TfR-mCh was a gift from Dr. Michael Ehlers

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.09.02.278770v1 for bioRxiv preprint.