2xFKBP-mCh-KDEL
(Plasmid #173010)

• Purpose: FKBP anchor for retaining DHFR-fused cargoes in the ER in the presence of zapalog. Encodes ER retrieval motif (KDEL) at C-terminus of mCherry. Contains IRES following ORF for cloning cargo.
• Depositing Lab: Matthew Kennedy
• Publication: Bourke et al J Cell Biol. 2021 Sep 6;220(9). pii: 212461. doi: 10.1083/jcb.202103186. Epub 2021 Jul 9.

Backbone

• Vector backbone: pCAG
• Backbone size w/o insert (bp): 5478
• Total vector size (bp): 7005
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 2xFKBP-mCh-KDEL
• Species: Synthetic
• Insert Size (bp): 1527
• Promoter: Chicken beta actin (CAG)
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tagagcctctgctaaccatg
• 3′ sequencing primer: acgcacaccggccttat

Resource Information

• Supplemental Documents:
  • 2xFKBP_mChKDEL_IRES_MCS 2.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2020.09.02.278770v1 for bioRxiv preprint.