pSecEffector
(Plasmid
#172891)
-
PurposeContains TEVp display cassette, atc inducible (in any E. coli strain) BxbI and arabinose inducible TP901
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZA
- Backbone size w/o insert (bp) 1817
- Total vector size (bp) 10736
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameBxb1
-
Insert Size (bp)1127
- Promoter nTETO
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tccctatcagtgatagaga (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTP901
-
Insert Size (bp)1526
- Promoter pBAD /AraC
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameTEV Display cassette
-
Insert Size (bp)3298
- Promoter ProD
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGTATTAACTTGAAGGCTACGTCC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameProD promoter between anti aligned Bxb1 sites
-
Insert Size (bp)262
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGTATTAACTTGAAGGCTACGTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBxb1 and TP901 amplified from Addgene plasmid #44456
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSecEffector was a gift from Urartu Seker (Addgene plasmid # 172891 ; http://n2t.net/addgene:172891 ; RRID:Addgene_172891) -
For your References section:
A Self-Actuated Cellular Protein Delivery Machine. Ahan RE, Kirpat BM, Saltepe B, Seker UOS. ACS Synth Biol. 2019 Apr 19;8(4):686-696. doi: 10.1021/acssynbio.9b00062. Epub 2019 Mar 12. 10.1021/acssynbio.9b00062 PubMed 30811932