pET22b-PelB-6H-Ag43-160N-sfGFP
(Plasmid #172886)

• Purpose: Display sfGFP protein on E. coli cell surface
• Depositing Lab: Urartu Seker
• Publication: Ahan et al ACS Synth Biol. 2019 Apr 19;8(4):686-696. doi: 10.1021/acssynbio.9b00062. Epub 2019 Mar 12.

Backbone

• Vector backbone: pET22b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5359
• Total vector size (bp): 8727
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: SfGFP
• Alt name: SfGFP
• Species: Synthetic
• Insert Size (bp): 714
• Promoter: T7 Promoter
• Tags / Fusion Proteins:
  • HHHHHH (N terminal on insert)
  • TEV recognition site (ENLYFQG) (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Gene/Insert 2

• Gene/Insert name: Ag43, partial
• Alt name: flu gene
• Insert Size (bp): 1107
• Mutation: Deleted 1-160 (N terminal)
• Entrez Gene: flu (a.k.a. b2000, ECK1993, agn, agn43, yeeQ, yzzX)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAAAACCTGTACTTTCAGGGC
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pet22b-ag43-160n-6h-sfgfp-ampr.gb
• A portion of this plasmid was derived from a plasmid made by: sfGFP amplified from pJT119b vector (addgene #50551)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry