Skip to main content
Addgene

pSF3-microID
(Plasmid #172880)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172880 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSF3
  • Backbone size w/o insert (bp) 8488
  • Total vector size (bp) 9042
  • Vector type
    Mammalian Expression, Retroviral, Luciferase ; to be used in a tet-on or tet-off compatible cell line

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    microID
  • Species
    aquifex aeolicus
  • Insert Size (bp)
    554
  • Mutation
    fragment ([aa2-171]) of aquifex aeolicus BirA with the substitution R40G
  • Promoter TRE-cmv
  • Tag / Fusion Protein
    • myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site FseI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer aaaggccggccccatggaacaaaaactcatctc
  • 3′ sequencing primer tatactttctagagaataggaac
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The template for the original PCR is addgene number: 74223

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSF3-microID was a gift from Julien Béthune (Addgene plasmid # 172880 ; http://n2t.net/addgene:172880 ; RRID:Addgene_172880)
  • For your References section:

    Engineering of ultraID, a compact and hyperactive enzyme for proximity-dependent biotinylation in living cells. Kubitz L, Bitsch S, Zhao X, Schmitt K, Deweid L, Roehrig A, Barazzone EC, Valerius O, Kolmar H, Bethune J. Commun Biol. 2022 Jul 4;5(1):657. doi: 10.1038/s42003-022-03604-5. 10.1038/s42003-022-03604-5 PubMed 35788163