Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pet-15b-ultraID
(Plasmid #172879)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172879 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET-15b
  • Backbone manufacturer
    Novagen (EMD Millipore)
  • Backbone size w/o insert (bp) 5657
  • Total vector size (bp) 6224
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ultraID
  • Species
    aquifex aeolicus
  • Insert Size (bp)
    567
  • Mutation
    fragment ([aa2-171]) of aquifex aeolicus BirA with the substitutions R40G and L41P
  • Promoter T7
  • Tag / Fusion Protein
    • myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site SmaI (destroyed during cloning)
  • 5′ sequencing primer taatacgactcactatagg
  • 3′ sequencing primer tagaggccccaaggggttatg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    the insert sequence is derived from Addgene number 74223

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pet-15b-ultraID was a gift from Julien Béthune (Addgene plasmid # 172879 ; http://n2t.net/addgene:172879 ; RRID:Addgene_172879)
  • For your References section:

    Engineering of ultraID, a compact and hyperactive enzyme for proximity-dependent biotinylation in living cells. Kubitz L, Bitsch S, Zhao X, Schmitt K, Deweid L, Roehrig A, Barazzone EC, Valerius O, Kolmar H, Bethune J. Commun Biol. 2022 Jul 4;5(1):657. doi: 10.1038/s42003-022-03604-5. 10.1038/s42003-022-03604-5 PubMed 35788163