pSF3-ultraID
(Plasmid #172878)

• Purpose: expresses ultraID in mammalian cells with the tet-on or tet-off system
• Depositing Lab: Julien Béthune
• Publication: Kubitz et al Commun Biol. 2022 Jul 4;5(1):657. doi: 10.1038/s42003-022-03604-5.

Backbone

• Vector backbone: pSF3
• Backbone size w/o insert (bp): 8488
• Total vector size (bp): 9042
• Vector type: Mammalian Expression, Retroviral, Luciferase ; to be used in a tet-on or tet-off compatible cell line

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ultraID
• Species: aquifex aeolicus
• Insert Size (bp): 554
• Mutation: fragment ([aa2-171]) of aquifex aeolicus BirA with the substitutions R40G and L41P
• Promoter: TRE-cmv
• Tag / Fusion Protein:
  • myc (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: FseI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: aaaggccggccccatggaacaaaaactcatctc
• 3′ sequencing primer: tatactttctagagaataggaac

Resource Information

• Supplemental Documents:
  • pSF3-ultraID.gb
• A portion of this plasmid was derived from a plasmid made by: The template for the original PCR is addgene number: 74223
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry