pAG876 pDisplay-pFAST
(Plasmid #172868)

• Purpose: expresses pFAST at the surface of mammalian cells
• Depositing Lab: Arnaud Gautier
• Publication: Benaissa et al Nat Commun. 2021 Nov 30;12(1):6989. doi: 10.1038/s41467-021-27334-0.

Backbone

• Vector backbone: pDisplay
• Total vector size (bp): 5680
• Modifications to backbone: 5008
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pFAST-PDGFR
• Alt name: pFAST fused to PDGFR transmembrane protein
• Species: Synthetic
• Insert Size (bp): 672
• Promoter: CMV
• Tags / Fusion Proteins:
  • IgK leader sequence (N terminal on insert)
  • Myc tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.01.29.428635v2 for bioRxiv preprint.