pAd-PV-NES-DsRed
(Plasmid #17286)

• Depositing Lab: Anton Bennett
• Publication: Rodrigues et al J Biol Chem. 2007 Jun 8. 282(23):17061-8.

Backbone

• Vector backbone: Adenoviral Recombinant (pAdEasy)
• Backbone size w/o insert (bp): 33400
• Vector type: Mammalian Expression, Adenoviral

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: PV-NES
• Alt name: PV-NES-DsRed-myc
• Alt name: Parvalbumin
• Species: R. norvegicus (rat)
• Insert Size (bp): 1100
• GenBank ID: M12725
• Entrez Gene: Pvalb (a.k.a. PALB1, Pva)
• Tags / Fusion Proteins:
  • DSR (C terminal on insert)
  • Myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: GTGGCAAAAGTGACGTTTTTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

AdEasy is a registered trademark of the Johns Hopkins University.