Skip to main content
Addgene

AAV-hSyn-Axon-jGCaMP8m
(Plasmid #172719)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172719 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Axon-jGCaMP8m
  • Species
    M. musculus (mouse), R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
  • Insert Size (bp)
    1329
  • Promoter hSyn
  • Tag / Fusion Protein
    • 6xHis (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TCGTGTCGTGCCTGAGAGCG
  • 3′ sequencing primer cagcgtatccacatagcgtaaa
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    GCaMP8m from #162375.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-hSyn-Axon-jGCaMP8m was a gift from Marianne Fyhn (Addgene plasmid # 172719 ; http://n2t.net/addgene:172719 ; RRID:Addgene_172719)
  • For your References section:

    An updated suite of viral vectors for in vivo calcium imaging using intracerebral and retro-orbital injections in male mice. Grodem S, Nymoen I, Vatne GH, Rogge FS, Bjornsdottir V, Lensjo KK, Fyhn M. Nat Commun. 2023 Feb 4;14(1):608. doi: 10.1038/s41467-023-36324-3. 10.1038/s41467-023-36324-3 PubMed 36739289