Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

UBC1cer40GEM
(Plasmid #172699)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172699 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCambia1300
  • Backbone manufacturer
    pCambia
  • Backbone size w/o insert (bp) 8900
  • Total vector size (bp) 1200
  • Vector type
    Plant Expression, Unspecified
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    monomer of 60mer GEM
  • Species
    A. thaliana (mustard weed); N. benthamiana
  • Insert Size (bp)
    3500
  • Promoter UBC1
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTTTTCCCAGTCACGACGTTG
  • 3′ sequencing primer TGAGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    UBC1cer40GEM was a gift from Krishna Niyogi (Addgene plasmid # 172699 ; http://n2t.net/addgene:172699 ; RRID:Addgene_172699)
  • For your References section:

    Quantitative imaging of RNA polymerase II activity in plants reveals the single-cell basis of tissue-wide transcriptional dynamics. Alamos S, Reimer A, Niyogi KK, Garcia HG. Nat Plants. 2021 Aug;7(8):1037-1049. doi: 10.1038/s41477-021-00976-0. Epub 2021 Aug 9. 10.1038/s41477-021-00976-0 PubMed 34373604