Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCGB42
(Plasmid #17266)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 17266 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPC16
  • Backbone size (bp) 8030
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • B42•HA (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer CCAGCCTCTTGCTGAGTGGAGATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ref for pPC16: Chevray, P. M. & Nathans, D. (1992) Proc. Natl. Acad. Sci. USA 89, 5789-5793.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCGB42 was a gift from Stuart Schreiber (Addgene plasmid # 17266 ; http://n2t.net/addgene:17266 ; RRID:Addgene_17266)
  • For your References section:

    A yeast genetic system for selecting small molecule inhibitors of protein-protein interactions in nanodroplets. Huang J, Schreiber SL. Proc Natl Acad Sci U S A. 1997 Dec 9. 94(25):13396-401. 10.1073/pnas.94.25.13396 PubMed 9391035
Commonly requested with: