PB-HD118
(Plasmid
#172655)
-
PurposeExpressing paired pegRNAs from human U6 and H1 promoters to make 118-bp deletion on HPRT1 gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepiggyBAC-U6-BlastR
-
Vector typeCRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepegRNA-HD118A/pegRNA-HD118B
-
gRNA/shRNA sequenceunspecified
-
SpeciesSynthetic
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.12.30.424891v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-HD118 was a gift from Jay Shendure (Addgene plasmid # 172655 ; http://n2t.net/addgene:172655 ; RRID:Addgene_172655) -
For your References section:
Precise genomic deletions using paired prime editing. Choi J, Chen W, Suiter CC, Lee C, Chardon FM, Yang W, Leith A, Daza RM, Martin B, Shendure J. Nat Biotechnol. 2021 Oct 14. pii: 10.1038/s41587-021-01025-z. doi: 10.1038/s41587-021-01025-z. 10.1038/s41587-021-01025-z PubMed 34650269