pMSCV-FLAG-2xSTREP-CCND1(P287A)-Puro
(Plasmid
#172641)
-
PurposeRetroviral vector for the constitutive expression of FLAG-2xSTREP-tagged cyclin D1(P287A) and a puromycin resistance marker in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172641 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMSCV-Puro
-
Backbone manufacturerTakara Bio
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCCND1
-
Alt namecyclin D1
-
Alt nameBCL1
-
SpeciesH. sapiens (human)
-
MutationPro287Ala
-
Entrez GeneCCND1 (a.k.a. BCL1, D11S287E, PRAD1, U21B31)
-
Tag
/ Fusion Protein
- FLAG-2xSTREP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-FLAG-2xSTREP-CCND1(P287A)-Puro was a gift from Michele Pagano (Addgene plasmid # 172641 ; http://n2t.net/addgene:172641 ; RRID:Addgene_172641) -
For your References section:
CRL4(AMBRA1) is a master regulator of D-type cyclins. Simoneschi D, Rona G, Zhou N, Jeong YT, Jiang S, Milletti G, Arbini AA, O'Sullivan A, Wang AA, Nithikasem S, Keegan S, Siu Y, Cianfanelli V, Maiani E, Nazio F, Cecconi F, Boccalatte F, Fenyo D, Jones DR, Busino L, Pagano M. Nature. 2021 Apr;592(7856):789-793. doi: 10.1038/s41586-021-03445-y. Epub 2021 Apr 14. 10.1038/s41586-021-03445-y PubMed 33854235